எழுத்தறிவித்தவன் இறைவன்- வென்டரின் மகோன்னத சாதனை

இதே விஷயத்தை இன்னும் சிறப்பான முறையில், தெளிவான நடையில், இன்னும் இனிய தமிழில் தந்திருக்கிறார் மேலிருப்பான். அதைப் படிக்காதவர்கள் இதைப் படிக்கவும்.

அமெரிக்காவில் க்ரைக் வென்டர் என்பவர் புதிதாக உயிரைப் படைத்திருக்கிறார் என்பதைப் படித்திருப்பீர்கள். இது குறித்த சர்ச்சைகள் பெரும் விவகாரமாகப் போய்க கொண்டிருக்கின்றன. இப்படிப்பட்ட முயற்சிகள் மனிதனுக்கு ஊறு விளைவிக்கும் உயிரிகள் உருவாகக் காரணமாய்ப் போய் விடும் என்று ஒரு சாராரும், அப்படியெல்லாம் ஆகாது, வென்டரின் ஆய்வுகள் மனிதனுக்கு மரணமில்லாப் பெருவாழ்வு கொடுக்கும் என்று மறு சாராரும் தீர்மானமாய் சொல்கிறார்கள். அப்படி என்ன செய்தார் வென்டர்?

முதலில் இந்த மேற்கோளைப் படியுங்கள்:

ரிச்சார்ட் டாக்கின்ஸ்:

பூமியிலிருந்துத் துடைக்கப்பட்டுவிட்ட நியாண்டர்த்தாலை மறுபடியும் உயிரோடு திரும்பக் கொண்டு வர முடியுமா என்றால், இயலும். வென்டரின் சாதனை அதற்கான சாத்தியக்கூறுகளை உருவாக்கி இருக்கிறது.

உதாரணமாக புதிதாய் ஒரு ஆடு செய்ய நினைக்கிறோம், நாம் என்ன செய்ய வேண்டும்? முதலில் இண்டர்நெட்டைத் திறக்க வேண்டும். அங்கிருந்து “ஷீப் ஜீனோம் ப்ராஜெக்ட்” தொடர்பான டாட்டா பைல்களைத் தரவிறக்கம் செய்ய வேண்டும். அதன் பின் A, T, C and G என்று லேபல் ஒட்டப்பட்டிருக்கிற நான்கு பாட்டில் ரசாயனங்களைக் கொண்டு அடுத்த கட்டமாக குரோமோசோம்களை உருவாக்கி ஒரு ஆட்டின் செல்லில் வைத்து விடலாம்.

தேவைப்பட்டால் இன்னும் மென்மையான ரோமம் தரக்கூடிய ஜீன்களை இந்த சிந்தெடிக் செல்லில் இட்டு நிரப்பலாம். அந்த ஆடு எதை எல்லாம் சாப்பிடும் என்பதை நம் இஷ்டத்துக்கு மாற்றி எழுதலாம்- அவ்வளவு ஏன், அந்த ஆடுகள் நீர்நிலைகளில் வாழக்கூடியனவாக இருப்பின் ஆட்டரின் ஜீன்களை உள்ளே புகுத்தி அது தண்ணீரில் நீந்தி விளையாடத் துணை செய்யலாம்.

இதன் சாத்தியக்கூறுகளுக்கு எல்லையில்லை. நியான்டர்த்தால் ஜீன்களைக் கொண்டு பல்லாயிரக்கணக்கான ஆண்டுகளுக்கு முன் இறந்தவனை உயிர்த்தெழச் செய்யலாம்- ஒன்றிரண்டு ஜீன்கள் குறைபடின் சிம்பன்ஜீக்கள் அல்லது மனிதர்களிடமிருந்து இரவல் வாங்கிக் கொடுக்கலாம். கல்லறையில் கிடக்கும் சார்லஸ் டார்வினின் இரட்டை சகோதரனை இப்போது உருவாக்கலாம்- அவருக்கு ஆல்பர்ட் ஐன்ஸ்டீனின் ஜீன்களைக் கொடுத்து இன்னும் திறமைசாலியாக்கலாம்…

அப்படி என்னதான் செய்தார் வென்டர்?

மைகொப்லாஸ்மா மைகோய்ட்ஸ் என்ற பாக்டீரியத்தின் ஜீனோமின் ஒவ்வொரு எழுத்தையும் படித்து, ஆய்வுக் கூடத்தில் நான்கு பாட்டில் ரசாயனங்களைக் கொண்டு அச்சுக்கு அச்சுக்கு அதை அப்படியே நகலெடுத்தார்கள் அவரது ஆய்வுக் கூடத்தைச் சேர்ந்த விஞ்ஞானிகள். தங்கள் தயாரிப்பு செயற்கையானது, சிந்தெடிக் என்று காட்டுவதற்காக அதனுள் சில வெத்து டிஎன்ஏக்களை கோத்து விட்டார்கள். இதை எடுத்துப் போய், அந்த பாக்டீரியத்தைப் பெருமளவில் ஒத்த இன்னொரு பாக்டீரியம்- மைகொப்லாஸ்மா காப்ரிகோளம்-, அதன் செல்லுக்குள்ளிருக்கிற ஜீநோம்களைக் கழுவி அதை வெற்றுக் கூடாக்கி, அதனுள் தாங்கள் நகலெடுத்த ஜீனோம்களை இட்டார்கள். இந்த செல் இப்போது ஒழுங்காக வேலை செய்கிறது- தன வேலையை அல்ல, அந்த இன்னொரு பாக்டீரியத்தின் செல் செய்ய வேண்டிய வேலையை. இந்த செயற்கை பாக்டீரியத்தின் பெயர் சிந்தியா (அவள் சிந்தெடிக் பாக்டீரியாவாச்சே!).

வென்டர் செய்திருக்கிற சாதனையை சுருக்கமாக சொல்ல வேண்டுமென்றால், ஒரு இன டிஎன்ஏக்களை நகலெடுத்து வேறோன்றினுள் நுழைத்திருக்கிறார் அவர். உள்ளே நுழைந்த டிஎன்ஏ சொன்ன மாதிரி வேலை செய்து அது கேட்ட புரதங்களைத் தயாரித்துத் தந்திருக்கிறது உயிர்க்கூடாயிருந்த தாய் பாக்டீரிய செல்.

ப்ளூ ஹெரான் என்ற நிறுவனம் டிஎன்ஏக்களை செயற்கையாக தயார் செய்கிறது. அதனிடமிருந்து ஆயிரம் யூனிட் நீளம் இருக்கிற செயற்கை டிஎன்ஏக்களை வாங்கி அதை முழு ஜீனோமாக அசெம்பிள் பண்ணினார்களாம் வென்டரின் ஆய்வாளர்கள். அவர்களாக வடிவமைத்த தொழில் நுட்பத்தின் மூலமாக. மொத்த செலவு நாற்பது மில்லியன் டாலர்கள்.

ஆல்கேக்களைக் கொண்டு பெட்ரோலுக்கு மாற்று கண்டு பிடித்தால் அறுநூறு மில்லியன் டாலர் தருவதாக சொல்லியிருக்கிறதாம் எக்ஸ்சான் என்ற பெட்ரோல் நிறுவனம். வென்டரும் தனது கடற்பயணங்களில் நாற்பது மில்லியன் ஆல்கே ஜீன்களைத் தனது நூலகத்தில் தொகுத்து வைத்திருக்கிறாராம்.

வென்டர் தற்போது செய்திருக்கிற சாதனையின் மதிப்பு ஒரு ட்ரில்லியன் டாலர்களுக்கு மேல் இருக்குமாம்.

வென்டர் செய்த வேலை:

ஆடுகளைத் தாக்கும் இயற்கை பாக்டீரியாவைக் கொண்டு செயற்கையாக ஒரு ஜீனோமைத் தயாரித்திருக்கிறார் வென்டர். அவர் தனது செயற்கை ஜீனோமைத் தயாரிக்கையில் ஆடுகளின் உடலில் வியாதியை உண்டாக்குகிற அந்த பாக்டீரியாவின் ஜீனோமிலிருந்து, அவற்றுக்கு வியாதியைத் தருகிறப் பிரத்யேகப் பதினான்கு ஜீன்களைத் தூக்கி விட்டாராம்- இந்த செயற்கை பாக்டீரியா ஆய்வுக்கூடத்தை விட்டு தப்பி ஓடி விட்டால்கூட பிற்காலத்தில் அதனால் ஆடுகளுக்கு ஆபத்து வராது என்கிறார்கள். இது தவிர, ஒரு குறிப்பிட்ட ஆன்ட்டிபயாட்டிக் மற்றும் தனக்கென குறிப்பிட்ட ஒரு ரசாயன மீடியம் இல்லாத சூழலில் அது வாழ முடியாத வண்ணம் அதன் மரபணுக்களை மாற்றி எழுதி இருக்கிறார்கள். இதனால் இவை பாதுகாப்பானவையாக, தப்பிச் சென்றால் வாழ முடியாதபடி ஆக்க்கப்பட்டிருக்கின்றன.

வென்டர் மற்றும் ஆய்வாளர்கள் அமைத்த பாக்டீரியாவில் நமது ரூபாய் நோட்டுகளில் இருக்கிற மாதிரியான நீர்த்தடங்கள் இருக்கின்றன- அவையே அந்த பாக்டீரியாக்கள் செயற்கையாக ஆக்கப்பட்டனவை என்பதற்கான அத்தாட்சி.

அந்தத் தடங்கள்-

ஆய்வாளர்கள் டிஎன்ஏவை எழுத உபயோகித்த சங்கேத மொழி (கோடிங் சிஸ்டம்) பற்றிய விளக்கம்; ஒரு இணைய தள முகவரி- உரலி; ஆய்வுக்கு உதவிய நாற்பத்தாறு ஆய்வாளர்களின் பெயர்களும் முகவரியும். இவை தவிர புகழ்பெற்ற மேற்கோள்கள் சிலவும். அனைத்து டிஎன்ஏக்களிலும் காணப்படும் G,A,T,C- இந்த நான்கே நான்கு எழுத்துக்களை வைத்து அத்தனையும் செய்திருக்கிறார்கள்:

உதாரணமாக,

* CRAIGVENTER என்ற பெயர் இவ்வாறு
TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA கோடிங் செய்யப்பட்டிருக்கிறது.

இதில் காணப்படும் மேற்கோள்கள்-

* “வாழ, பிழையிழைக்க, வீழ, வெல்ல, உயிரிலிருந்து உயிர் படைக்க”- ஜேம்ஸ் ஜாய்ஸ்
* “எது எப்படி இருக்கிறது என்பதைப் பார்க்காதே, எப்படி இருக்க முடியும் என்பதைப் பார்”- ராபர்ட ஒப்பன்ஹீமர் மற்றும் முதல் அணுகுண்டைப் பற்றி விவாதிக்கும் புத்தகத்திலிருந்து ஒரு மேற்கோள்

* “என்னால் செய்து பார்க்க முடியாத ஒன்றை என்னால் புரிந்து கொள்ள முடியாது”- ரிச்சர்ட் பீன்மேன், தனது கரும்பலகையில் இறுதியாய் எழுதி வைத்த வார்த்தைகள்.

இடர்களில் இரண்டு:

முதலில் அவர்கள் தேர்ந்தெடுத்த பாக்டீரிய ஜீனோம் மெதுவாக வளரக்கூடியது- எனவே அவர்கள் அதனோடு தொடர்புடைய மைகொப்லாஸ்மா காப்ரிகோளம் என்ற பாக்டீரியாவைத் தேர்ந்தேடுத்தார்கள். ஆனால் அது அந்நிய டிஎன்ஏக்களைக் கழித்துக் கட்டக்கூடிய எதிர்ப்பு சக்தி கொண்டதாயிருந்தது. அதனிடம் இருந்த ஒரு கட்டறுப்பு என்ஜைம் வெளியிலிருந்து வருகிற டிஎன்ஏக்களைத் துண்டு துண்டாக வெட்டி அழித்தது. ஆய்வாளர்கள் இதற்குக் காரணமாக இருந்த ஜீனைத் தேடிப் பிடித்து அந்த ஜீனோமிலிருந்து கழித்துக் கட்டினார்கள்.

அவர்கள் செயற்கையாகத் தயாரித்த ஜீனோமின் கோடிக்கணக்கான பேஸ்களில் ஒரே ஒரு ஒரு ஜோடி மட்டும் விட்டுப் போயிருந்தது- அதுவும் அது மிக முக்கியமான dnaA என்ற ஜீனில் இருந்தது. இதை சரி செய்ய, சின்ன சின்ன துண்டுகளாக ஜீனோமை இடம் மாற்றி, எங்கே குறை இருக்கிறது என்று கண்டு பிடித்து குறையை நீக்கினார்கள். அதன் பின்தான் வேலை சுல்பமாகியது.

ஆனால் ஆரம்பித்திலேயே இந்த மாதிரியான சோதனைகளை இவர்கள் சந்திக்க வேண்டியிருந்தது, நாம் போக வேண்டிய தூரம் அதிகம் இருக்கிறது என்பதைத்தான் காட்டுகிறது.

வேன்டரின் சாதனை- உண்மை நிலை:

நமது கணினி என்பது எப்படி வெவ்வேறு பாகங்கள் ஒன்று சேர்ந்து உருவான ஒன்றோ, அதுபோல்தான் உயிர்களும். டிஎன்ஏ என்று எடுத்துக் கொண்டால், அதில் உள்ள விஷயம் ஜீன்களில் உள்ளது. ஜீன்கள் புரதங்களை உருவாக்குவதற்கும், அதை எங்கே எப்படி பயன்படுத்தவேண்டும் என்பதற்குமான ஆணைகளை வைத்திருக்கின்றன. ஜீன்களின் மூலம் உருவாகும் புரதங்கள், ஒன்றோடொன்று இணைந்து இயங்கி ஒரு செல்லின் பல வேலைகளை செய்து முடித்துத் தருகின்றன.

ஒரு டிஎன்ஏவில் உள்ள எல்லா ஜீன்களும் அதற்கு அத்தியாவசியமானவை என்று சொல்ல முடியாது- சில குப்பைகளும் தன பாட்டுக்கு இருந்து கொண்டிருக்கலாம்- அவற்றை இழப்பதனாலும் நஷ்டம் ஒன்றும் ஏற்படுவதில்லை.

2002ல் எக்கார்ட் விம்மர் என்பவர் போலியோ வைரஸின் ஜீனோமை இந்த மாதிரி செயற்கையாக வடிவமைத்திருக்கிறார். அது எலிகளைத் தாக்கிக் கொல்லும் வேலையை செவ்வனே செய்து முடித்தது. வென்டர் செய்தது அடிப்படையில ஏறத்தாழ இந்த மாதிரிதான், ஆனால் போலியோ ஜீனோமின் நீளம் வெறும் 7,500 யூனிட்டுகள் நண்பர்களே, வென்ண்டரின் ஜீனோம் அதை விட நூறு மடங்கு நீளமானது. இதைவிட ஆச்சரியமான செய்தி, முப்பது வருடங்களுக்கு மேலாக நாம் உபயோகிக்கிற இன்சுலின் மரபணு மாற்றம் செய்யப்பட்ட பாக்டீரியாக்களால்தான் தயாரிக்கப்படுகிறது என்பதுதான். இப்போது இது.

இந்த சாதனை, இயற்கையில் இல்லாத பாக்டீரியாக்களுக்கான ஜீனோம்களை ஆராய்ச்சிக்கூடங்களில் உருவாக்க முடியும் என்பதையே உணர்த்துகிறது. வென்டர் ஒரு பிள்ளையார் சுழி போட்டிருக்கிறார் அவ்வளவுதான். இன்னும் எவ்வளவோ இருக்கிறது. அவர் ஏற்கனவே இருக்கிற ஒரு பாக்டீரியாவின் டிஎன்ஏக்களை வேறொரு செல்லில் தரவிறக்கம் செய்திருக்கிறார் என்று சொல்லலாம், அந்த அளவில்தான் இருக்கிறது அவரது சாதனை -ஆனால் இதில் ஒரு சிறப்பு என்னவென்றால், அவர் காப்பி செய்த டிஎன்ஏயில் சில மாற்றங்களை செய்து பதித்திருக்கிறார்- அது செயற்கையாய் படைக்கப்பட்டது என்பதை தெரிவிக்கும் விதமாக.

இப்போது இந்தத் துறையில் உள்ள தொழில்நுட்பத்தைக் கொண்டு நம்மால் ஒரு குறிப்பிட்ட புரதத்தை செய்யும்படியான டிஎன்ஏக்களை வடிவமைக்க முடியும், ஆனால் அந்த புரதம் எப்படி இருக்கும் என்றோ, அது செல்லில் இருக்கிற மற்ற புரதங்களோடு எப்படி இணைந்து செயல்படும் என்பதையோ தீர்மானிக்க முடியாது. அதே போல், டிஎன்ஏவை வடிவமைக்கத் தெரிந்த நமக்கு ஒரு செல்லை உருவாக்கத் தெரியாது- இது எப்படி இருக்கிறதென்றால், பாட்டரி செய்து விட்டோம்- கார்தான் இன்னும் தயாராகவில்லை என்கிறமாதிரி. வென்டர் செய்திருப்பது ஒரு காரில் இருக்கிற பாட்டரியை சில ஜோடனைகள் செய்து வேறொரு காரில் அமர்த்துவது போன்ற காரியத்தைத்தான். இன்னும் வெகு தூரம் போக வேண்டி இருக்கிறது.

மரபணுத்துறையினரின் நோக்கம்:

இவர்களின் கனவு என்னவென்றால் நாம் எப்படி இயந்திரங்களை வடிவமைத்துத் தயாரிக்கிறோமோ, அது போல் நமது தேவைகளுக்கு ஏற்ப ஜீவராசிகளைப் பணிப்பதுதான். தடுப்பு மருந்தை உற்பத்தி செய்யக் கூடிய நுண்ணுயிர்களையும், கார்பன் டை ஆக்சைடை பெட்ரோல் போன்ற பொருட்களாய் மாற்றக்கூடிய ஆல்கேக்களையும் வடிவமைக்க விழைகிறார்கள். ஒரு பாக்டீரியாவை எடுத்துக் கொண்டு அதனுள் நாம் எழுதிய டிஎன்ஏவை செலுத்தி, அதை நமக்கு வேண்டிய வேலைகளை செய்ய வைக்க வேண்டும்: இந்த செயற்கை உயிரிகள் நமக்கு வேண்டிய ஒன்றைத் தயார் செய்து தரும் (பெட்ரோல், மருந்து இந்த மாதிரி). விஷங்களை ஜீரணித்து பூமியைத் தூய்மை செய்து கொடுக்கும (அணு உலைக கழிவு, தொழிற்சாலைகளின் மாசுப் பொருட்கள் இந்த மாத்ரி).

ஒரு பாக்டீரியத்தின் ஜீனோமை முழுமையாக மாற்றி எழுதுவது. நமக்கு வேண்டாத வேலைகளை நீக்கி விட்டு, நமக்கு வேண்டிய வேலைகளை அது செய்யும்படி அதை அடக்கி ஆள்வது- எப்படிப்பட்ட விஷயம்: மனிதன் மற்ற அனைத்து மிருகங்களின் மீதும் கொடுங்கொலோச்சுவதன் உச்ச திறன் அல்லவா இது! எந்த ஒரு விளங்கானாலும் சரி, அதன் ஜீனோமின் ஒவ்வொரு எழுத்தையும் திருத்தி எழுதி அதை வசப்படுத்தி வைத்துக் கொள்வது மிகுந்த வல்லமை தரும் விஷயம்- அதை செய்ய முடிந்தால் நமக்கு வேண்டிய ஜீன்களை உள்ளே வைத்து வேலை வாங்க முடியும் என்கிறார்கள்.

வென்டர் பூமியில் பிறந்த உயிர்களில், ஒரு கணினியை அப்பா என்று சொல்லிக்கொள்ளக்கூடிய உயிரை நாங்கள் படைத்திருக்கிறோம் என்று சொல்லி இருக்கிறார். ஆனால் இது போன்ற முயற்சிகள் தேவை இல்லை என்று சொல்பவர்களும் இருக்கிறார்கள். இப்போது இருக்கிற தொழில்நுட்பம் ஆங்காங்கே ஜீன்களை மாற்றி எழுதுவதன் மூலம் நமக்கு வேண்டிய வேலைகளை செய்துத் தரும்படி பாக்டீரியாக்களைப் பணிக்க வல்லதாய் இருக்கிறது என்கிறார்கள் அவர்கள். வென்டர் போகிற திசையில் போனால் வருஷக்கணக்கில் விரயம் செய்ய வேண்டி வரும்.

மரபணுவியலரின் உச்சகட்ட சாதனை ப்ரூக்ஸ் சொல்வதை செய்வதாகத்தான் இருக்கும்:

அடுத்தது என்ன:-

*வெவ்வேறு உயிரினங்களின் ஜீன்களைக் கலந்து கட்டிய ஒரு புதிய, வாழக்கூடிய சிந்தெடிக் ஜீனோம்

*ஏற்கனவே இருக்கிற உயிரினங்களிடமிருந்து நகலெடுத்ததாக இல்லாமல், புதிதாய் வடிவமைக்கப்பட்ட ஜீன்களை உள்ளடக்கிய சிந்தெடிக் ஜீனோம்

*புரதங்களைத் தயாரிக்க இயற்கைக்கு மாறாய், புதிதாய் வெறு சில அமினோ ஆசிட்களைப் பயன்படுத்தும் பாக்டீரியா ஜீனோம்

*மேற்கண்ட அனைத்தையும் பயன்படுததிச் செய்த நுண்ணுயிரி

சில மேற்கோள்கள்:

வென்டர் சொன்னது:

“இது எங்களது இறுதி வெற்றி. இது உலகின் முதல் சிந்தெடிக் செல். முதல் தடவையாக நாம், கணினியில் சில தகவல்கள், நான்கு பாட்டில் ரசாயனப் பொருட்கள்- இவற்றைக் கொண்டு மில்லியன்கணக்கான எழுத்துக்களில் டிஎன்ஏ சாப்ட்வேர் எழுதி, அதை உயிரோடிக்கிற ஒரு ஜீவராசியில் இட்டு பூட் செய்திருக்க்றோம்.

“ஒரு குழந்தையின் தளர்நடை போன்றதுதான் இது- ஆனால் இதனால் தத்துவத்தில், நாம் சிந்திக்கும் முறையில், நாம் பயன்படுத்தும் கருவிகளில் பெரும் மாற்றம் ஏற்படும். நாங்கள் செய்திருக்கிற செல் ஒன்றும் அதிசயமான செல் அல்ல, அது எதற்கும் உபயோகப்படாது. ஆனால் அது ஒரு கோட்பாட்டை நிரூபணம் செய்கிறது. இது மிகவும் பெரிய விஷயம்- இந்த நிரூபணம் இல்லாமல் அது வெறும் மனக்கோட்டையாக, அறிவியல் புதினமாகத்தான் இருந்திருக்கும். இது நம்மை, அந்த எல்லையைத் தாண்டி கொண்டு செல்கிறது, ஒரு புதிய உலகத்துக்கு.”

வேண்டர் தனது இமாலய சாதனையை அறிவிக்கும் காணொளி-

ப்ரீமன் டைசன் (பௌதிக அறிவியல் விஞ்ஞானி)

“இந்த ஆய்வு சிந்தெடிக் உயிரியல் என்ற புதிய உலகைத் திறந்து வைக்கிறது. டிஎன்ஏவைப் படித்து ஆவணப்படுத்தி ஆய்வுக்கூடத்தில் செயற்கை முறையில் தயாரித்துக் காட்டியிருப்பது, புது வகை உயிர்களைப் படைக்கத் தேவையான கருவிகள் அத்தனையும் நமக்குக் கிடைத்திருக்கிறது என்பதை நிரூபணம் செய்கிறது. இனி இந்தக் கருவிகள் மேம்படுத்தப்படும், எளிமைப்படுத்தப்படும், புதிய வாழ்வுயிர்கள் இன்னும் விரைவாகவும் மலிவு விலையிலும் படைக்கப்படும். இந்த புது தொழில்நுட்பம் எப்படிப்பட்ட புது கண்டுபிடிப்புகளையும் ஆச்சரியங்களையும் நமக்குத் தரும் என்பதை யாராலும் கணிக்க முடியாது. நான் ஒரு விஷயத்தில் தீர்மானமாய் இருக்கிறேன். புது உயிர் வடிவங்களை வடிவமைத்துப் படைக்கிற திறன் பூமியில் மானுட வரலாற்றில் ஒரு திருப்பு முனையாக இருக்கும்.

ஜார்ஜ் டைசன்: (அறிவியல் வரலாற்றியலாளர்)

இந்த ஆய்வை இருவிதமாகப் பார்க்கலாம். தொழில் நுட்பப்பார்வையில், ஒரு டிஜிட்டல் கணினியில் உருவாகிய சங்கேத மொழி இன்று உயிர் வாழும் செல்களில் ஜீனோம்களாக தன்னைப் பிறப்பித்துக் கொள்கிறது. உயிரியல் பார்வையில் பார்த்தால், ஒரு உயிர் தயாரித்த கோட் டிஜிட்டல் மொழியில் மாற்றப்பட்டிருக்கிறது- இது நகலெடுக்கப்பட்டு, எடிட் செய்யப்பட்டு, மற்ற செல்களுக்கு மாற்றப்படும் இயல்புடையதாய் இருக்கிறது.

விபரங்களை சேகரிக்க உதவிய சுட்டிகள்:

விபரங்களை சேகரிக்க உதவிய சுட்டிகள்:

“>http://arstechnica.com/science/news/2010/05/first-functional-synthetic-bacterial-genome-announced.ars

http://singularityhub.com/2010/05/24/venters-newest-synthetic-bacteria-has-secret-messages-coded-in-its-dna/